ORK07565

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07565

Order Kazusa clone(s) from :

Accession No	AB209911
Product ID	ORK07565
Clone name	ej00563
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	UBAP2
cDNA sequence	DNA sequence (4578 bp) Predicted protein sequence (99 aa)
Description	Homo sapiens mRNA for ubiquitin associated protein 2 isoform 3 variant protein.

Features of the cloned cDNA sequence

Description

Length: 4578 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	4276 bp
Genome contig ID	gi89161216r_33884479
PolyA signal sequence (None)	+--------+--------+----*----+---- GAACTGAAGAGCCTAACTGCCCTCTTTGTTTAGGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAGAAAAAATCTTTGGGAATAAACAAAATAACCCAAAT

Features of the protein sequence

Description

Length: 99 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD93148	1e-39	100.0	ubiquitin assoc...	Homo sapiens
CAM13516	1.9e-19	96.6	ubiquitin assoc...	Homo sapiens
AAF67493	2.5e-19	96.6	AD-012 protein ...	Homo sapiens
Q5T6F2	4.2e-19	96.6	Ubiquitin-assoc...	Homo sapiens
XP_528586	1.2e-18	95.0	ubiquitin assoc...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	15	SDFLFCTYIILYILYMMTSVSSD	37	PRIMARY	23