Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00233
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00233
Clone name ej00768
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol KIAA1468
cDNA sequence DNA sequence (4956 bp)
Predicted protein sequence (1051 aa)
Description
Features of the cloned cDNA sequence

Length: 4956 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1587 bp
Genome contig ID gi51511735f_57905497
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
CTATTATAAATAAAATGTTTTTGCATATGTTTTTG
Flanking genome sequence
(219839 - 219888)
----+----*----+----*----+----*----+----*----+----*
ATTTGGTTTGGGCTATGCATTTTACTTTCGTTTTGAAACACTATACTTTC

Features of the protein sequence

Length: 1051 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_512162 0 99.7 hypothetical pr...
Pan troglodytes
XP_001144840 0 98.6 hypothetical pr...
Pan troglodytes
XP_001089393 0 98.0 hypothetical pr...
Macaca mulatta
XP_001490157 0 95.9 hypothetical pr...
Equus caballus
XP_533386 0 95.9 hypothetical pr...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000357 430 466 PF02985 HEAT
IPR000357 469 506 PF02985 HEAT
IPR000357 833 869 PF02985 HEAT
HMMSmart IPR006594 90 122 SM00667 LisH dimerisation motif
ProfileScan IPR006594 90 122 PS50896 LisH dimerisation motif
IPR000357 839 877 PS50077 HEAT
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp