ORK06336

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06336

Order Kazusa clone(s) from :

Accession No	AB209127
Product ID	ORK06336
Clone name	fg01357
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PFKL
cDNA sequence	DNA sequence (5964 bp) Predicted protein sequence (400 aa)
Description	6-phosphofructokinase, liver type (EC 2.7.1.11) (Phosphofructokinase 1) (Phosphohexokinase) (Phosphofructo-1-kinase isozyme B) (PFK-B).

Features of the cloned cDNA sequence

Description

Length: 5964 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	823 bp
Genome contig ID	gi51511750f_44444407
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- ACCTTTTCTAGAAATAAAATCACCCTGACTGTGGG
Flanking genome sequence (127260 - 127309)	----+--------+--------+--------+--------+----* GTGCATCGGTCTCCGGAGAGCACAGCCTGCAGAACTCCTCAGAGAGAGGG

Features of the protein sequence

Description

Length: 400 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92364	1e-179	100.0	liver phosphofr...	Homo sapiens
AAH04920	4.6e-120	97.6	PFKL protein [H...	Homo sapiens
XP_001150050	4.8e-120	97.6	liver phosphofr...	Pan troglodytes
AAH18295	5.1e-120	97.6	PFKL protein [H...	Homo sapiens
XP_001150620	6.3e-120	97.6	liver phosphofr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR015913	178	234	PD000707	Phosphofructokinase_core
FPrintScan	IPR000023	58	77	PR00476	Phosphofructokinase
	IPR000023	83	96	PR00476	Phosphofructokinase
	IPR000023	142	158	PR00476	Phosphofructokinase
	IPR000023	176	193	PR00476	Phosphofructokinase
	IPR000023	194	212	PR00476	Phosphofructokinase
	IPR000023	215	231	PR00476	Phosphofructokinase
	IPR000023	233	250	PR00476	Phosphofructokinase
	IPR000023	304	326	PR00476	Phosphofructokinase
HMMPfam	IPR000023	55	330	PF00365	Phosphofructokinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp