Length: 6299 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end
Length of 3'UTR |
4535 bp |
Genome contig ID |
gi51511727r_56750036 |
PolyA signal sequence (AATAAA,-26) |
+----*----+----*----+----*----+---- AAATGATTTAATAAAGGGAACTGACTTTGGAAACC |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* ATGTCCTCATGCTTTCTTTGTAGCCTTGGTGTGTTGCTCCCACTTTTATT |
Length: 547 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92369 |
0 |
100.0 |
structure speci...
|
Homo sapiens
|
AAH91486 |
5.1e-40 |
59.5 |
SSRP1 protein [...
|
Homo sapiens
|
BAE30524 |
5.3e-40 |
58.9 |
unnamed protein...
|
Mus musculus
|
XP_849848 |
5.5e-40 |
59.5 |
similar to stru...
|
Canis lupus fam...
|
XP_859953 |
5.5e-40 |
59.5 |
similar to stru...
|
Canis lupus fam...
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Prediction of transmembrane (TM) segments
Method |
No. |
N terminal |
transmembrane region |
C terminal |
type |
length |
SOSUI2 |
1 |
335 |
KGFSLLLVLLFSLCHCLWFPIYL |
357 |
PRIMARY |
23 |
2 |
380 |
RLTAVSCLCGTQFGGNIAYADLR |
402 |
SECONDARY |
23 |
3 |
496 |
AGLGAGPAAWLPICAFAGLCPEC |
518 |
PRIMARY |
23 |