ORK07351

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07351

Order Kazusa clone(s) from :

Accession No	AB209148
Product ID	ORK07351
Clone name	fg07014
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	WDR20
cDNA sequence	DNA sequence (6516 bp) Predicted protein sequence (439 aa)
Description	WD repeat protein 20 (DMR protein).

Features of the cloned cDNA sequence

Description

Length: 6516 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	645 bp
Genome contig ID	gi51511730f_101640097
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AATTAAAGTTGTTTAATAAACATCTTTTTTCAAAG
Flanking genome sequence (106520 - 106569)	----+--------+--------+--------+--------+----* AAGCAGTTTGTAGCACTTTGATTGAGGTTCTGTGTACTAAGATACCCGTA

Features of the protein sequence

Description

Length: 439 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92385	3.3e-171	100.0	WD repeat domai...	Homo sapiens
XP_510174	3.8e-166	99.3	hypothetical pr...	Pan troglodytes
BAG52255	3.9e-166	99.5	unnamed protein...	Homo sapiens
Q8TBZ3	7.2e-166	99.0	WD repeat-conta...	Homo sapiens
CAI46118	7.3e-166	99.0	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	127	159	PD000018	WD40 repeat
HMMPfam	IPR001680	80	118	PF00400	WD40 repeat
	IPR001680	122	160	PF00400	WD40 repeat
	IPR001680	164	252	PF00400	WD40 repeat
HMMSmart	IPR001680	7	48	SM00320	WD40 repeat
	IPR001680	79	118	SM00320	WD40 repeat
	IPR001680	121	160	SM00320	WD40 repeat
	IPR001680	163	252	SM00320	WD40 repeat
ProfileScan	IPR001680	86	184	PS50294	WD40 repeat
ProfileScan	IPR001680	128	160	PS50082	WD40 repeat

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp