Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04832
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209305
Product ID ORK04832
Clone name fh00060
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol DRP2
cDNA sequence DNA sequence (5714 bp)
Predicted protein sequence (583 aa)
Description Dystrophin-related protein 2.
Features of the cloned cDNA sequence

Length: 5714 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 3874 bp
Genome contig ID gi89161218f_100261629
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
ATTCTGCTTTGAAAAGAATAAATTTGTACTTGTTT
Flanking genome sequence
(144514 - 144563)
----+----*----+----*----+----*----+----*----+----*
ACTTTGGTTCCTCTGGTTATACTCTCTGAGTCTGATATTTCATATCTTTC

Features of the protein sequence

Length: 583 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92542 0 100.0 dystrophin rela...
Homo sapiens
AAI11696 0 100.0 Dystrophin rela...
Homo sapiens
BAF82514 0 100.0 unnamed protein...
Homo sapiens
EAX02844 0 100.0 dystrophin rela...
Homo sapiens
Q13474 0 99.8 Dystrophin-rela...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR015153 10 130 PF09068 EF-hand
IPR015154 134 225 PF09069 EF-hand
IPR000433 230 275 PF00569 Zinc finger
HMMSmart IPR000433 230 275 SM00291 Zinc finger
ProfileScan IPR000433 230 277 PS50135 Zinc finger
ScanRegExp IPR000433 236 263 PS01357 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp