ORK04622

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04622

Order Kazusa clone(s) from :

Accession No	AK226133
Product ID	ORK04622
Clone name	fh09362
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CPZ
cDNA sequence	DNA sequence (5367 bp) Predicted protein sequence (408 aa)
Description	Carboxypeptidase Z precursor (EC 3.4.17.-) (CPZ).

Features of the cloned cDNA sequence

Description

Length: 5367 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	887 bp
Genome contig ID	gi89161207f_8530952
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- AGCCGCTGCCATTTTATTAAAGTGTTTTGATCCAC
Flanking genome sequence (141426 - 141475)	----+--------+--------+--------+--------+----* TTTGCACTGGAATGAGAGGATCTGTGTAAGGCACTTTCCAGGGAAGGCTG

Features of the protein sequence

Description

Length: 408 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW82332	1.2e-172	99.7	carboxypeptidas...	Homo sapiens
Q66K79	1.2e-172	99.7	Carboxypeptidas...	Homo sapiens
EAW82335	1.2e-167	97.9	carboxypeptidas...	Homo sapiens
AAB58911	2.6e-167	97.6	carboxypeptidas...	Homo sapiens
AAI33651	3.3e-152	88.1	CPZ protein [Bo...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000834	185	197	PR00765	Peptidase M14
	IPR000834	211	225	PR00765	Peptidase M14
	IPR000834	290	298	PR00765	Peptidase M14
	IPR000834	349	362	PR00765	Peptidase M14
HMMPfam	IPR000024	9	130	PF01392	Frizzled CRD region
HMMPfam	IPR000834	165	400	PF00246	Peptidase M14
HMMSmart	IPR000024	14	134	SM00063	Frizzled CRD region
HMMSmart	IPR000834	159	394	SM00631	Peptidase M14
ProfileScan	IPR000024	10	132	PS50038	Frizzled CRD region
ScanRegExp	IPR000834	352	362	PS00133	Peptidase M14

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp