Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04172
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209344
Product ID ORK04172
Clone name fh12815
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ARL17B
cDNA sequence DNA sequence (5196 bp)
Predicted protein sequence (179 aa)
Description ADP-ribosylation factor-like protein 17 (ADP-ribosylation factor 7 variant).
Features of the cloned cDNA sequence

Length: 5196 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 4592 bp
Genome contig ID gi51511734r_41668038
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TTTAAGTCATCACTAATAAAATGTATACATATTGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACATTGTTGACAGTTGTTATATTGTACTTTCTGTTTGTATTTTTATTGGT

Features of the protein sequence

Length: 179 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92581 2.9e-78 100.0 ADP-ribosylatio...
Homo sapiens
Q8IVW1 1.4e-77 100.0 ADP-ribosylatio...
Homo sapiens
AAH41803 2.3e-77 99.4 ARL17P1 protein...
Homo sapiens
XP_001135548 8.4e-77 98.8 similar to ADP-...
Pan troglodytes
AAH30570 3.9e-70 100.0 ADP-ribosylatio...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR006689 21 44 PR00328 ARF/SAR superfamily
IPR006689 49 73 PR00328 ARF/SAR superfamily
HMMPfam IPR006689 6 143 PF00025 ARF/SAR superfamily
HMMSmart IPR006688 3 175 SM00177 ADP-ribosylation factor
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp