ORK04207

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04207

Order Kazusa clone(s) from :

Accession No	AB209345
Product ID	ORK04207
Clone name	fh12850
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ATN1
cDNA sequence	DNA sequence (5522 bp) Predicted protein sequence (774 aa)
Description	Atrophin-1 (Dentatorubral-pallidoluysian atrophy protein).

Features of the cloned cDNA sequence

Description

Length: 5522 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	3103 bp
Genome contig ID	gi89161190f_6815712
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- GATGTTCCAGACAATAATAAATGCGCCTGTGACTT
Flanking genome sequence (109715 - 109764)	----+--------+--------+--------+--------+----* AGCCTTGGTGTCAGTCTCTTGCGGACCTGACAACCCCCATCTCTCCTTCC

Features of the protein sequence

Description

Length: 774 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92582	3.7e-180	100.0	atrophin-1 vari...	Homo sapiens
EAW88706	1.9e-174	98.3	atrophin 1, iso...	Homo sapiens
AAB51321	1.9e-174	98.3	DRPLA [Homo sap...	Homo sapiens
AAH51795	4.8e-174	98.1	Atrophin 1 [Hom...	Homo sapiens
Q5IS70	3.4e-173	97.9	Atrophin-1; Alt...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002951	97	121	PR01222	Atrophin
	IPR002951	311	332	PR01222	Atrophin
	IPR002951	427	448	PR01222	Atrophin
	IPR002951	451	475	PR01222	Atrophin
	IPR002951	486	511	PR01222	Atrophin
	IPR002951	585	608	PR01222	Atrophin
	IPR002951	651	672	PR01222	Atrophin
	IPR002951	690	710	PR01222	Atrophin
	IPR002951	719	741	PR01222	Atrophin
	IPR002951	744	765	PR01222	Atrophin
HMMPfam	IPR002951	2	774	PF03154	Atrophin

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp