ORK04762

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04762

Order Kazusa clone(s) from :

Accession No	AK226134
Product ID	ORK04762
Clone name	fh16050
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DGKA
cDNA sequence	DNA sequence (5434 bp) Predicted protein sequence (226 aa)
Description	Diacylglycerol kinase alpha (EC 2.7.1.107) (Diglyceride kinase alpha) (DGK-alpha) (DAG kinase alpha) (80 kDa diacylglycerol kinase).

Features of the cloned cDNA sequence

Description

Length: 5434 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	2507 bp
Genome contig ID	gi89161190f_54516198
PolyA signal sequence (None)	+--------+--------+----*----+---- ATAAAATGACTTGTGTTTCCCCTTTGGGATCTGCT
Flanking genome sequence (117876 - 117925)	----+--------+--------+--------+--------+----* AAGTAAGTGGTACACTTCCTTCTTTTATACCTTCACTCCTTAAATGACGT

Features of the protein sequence

Description

Length: 226 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW96850	5.6e-95	99.5	diacylglycerol ...	Homo sapiens
XP_001112067	5.8e-95	99.5	similar to diac...	Macaca mulatta
XP_001169813	5.8e-95	99.5	diacylglycerol ...	Pan troglodytes
XP_001112294	6.4e-95	99.5	similar to diac...	Macaca mulatta
AAH23523	6.5e-95	99.5	Diacylglycerol ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002219	59	73	PR00008	Protein kinase C
	IPR002219	87	98	PR00008	Protein kinase C
	IPR002219	164	176	PR00008	Protein kinase C
HMMPfam	IPR002048	15	43	PF00036	Calcium-binding EF-hand
	IPR002219	62	113	PF00130	Protein kinase C
	IPR002219	126	178	PF00130	Protein kinase C
HMMSmart	IPR002048	15	43	SM00054	Calcium-binding EF-hand
	IPR002219	62	109	SM00109	Protein kinase C
	IPR002219	124	175	SM00109	Protein kinase C
ProfileScan	IPR002048	11	46	PS50222	Calcium-binding EF-hand
	IPR002219	61	109	PS50081	Protein kinase C
	IPR002219	125	175	PS50081	Protein kinase C
ScanRegExp	IPR002048	24	36	PS00018	Calcium-binding EF-hand
	IPR002219	62	109	PS00479	Protein kinase C
	IPR002219	126	177	PS00479	Protein kinase C

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp