ORK04497

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04497

Order Kazusa clone(s) from :

Accession No	AB209380
Product ID	ORK04497
Clone name	fh19105
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CD81
cDNA sequence	DNA sequence (5235 bp) Predicted protein sequence (108 aa)
Description	CD81 antigen (26 kDa cell surface protein TAPA-1) (Target of the antiproliferative antibody 1) (Tetraspanin-28) (Tspan-28).

Features of the cloned cDNA sequence

Description

Length: 5235 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	619 bp
Genome contig ID	gi51511727f_2269189
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- CCGTCATTTAATAAAGAAGGAACATCAGGCATGCT
Flanking genome sequence (106015 - 106064)	----+--------+--------+--------+--------+----* ACCAGGCCTGTGCAGTCCCTCAGTGCCAGTGGTGTCTGAGACCTAGGGGT

Features of the protein sequence

Description

Length: 108 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92617	3.2e-47	100.0	CD81 antigen va...	Homo sapiens
EDL18193	4.1e-06	88.2	CD 81 antigen, ...	Mus musculus
CAB94774	5.3e-06	88.2	Tapa-1 protein ...	Mus musculus
BAE22950	5.3e-06	88.2	unnamed protein...	Mus musculus
P35762	5.3e-06	88.2	CD81 antigen; 2...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	71	SGKLYLIGIAAIVVAVIMVSGR	92	PRIMARY	22