ORK06208

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06208

Order Kazusa clone(s) from :

Accession No	AK226069
Product ID	ORK06208
Clone name	fh22128
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	NUMB
cDNA sequence	DNA sequence (5172 bp) Predicted protein sequence (574 aa)
Description	Protein numb homolog (h-Numb) (Protein S171).

Features of the cloned cDNA sequence

Description

Length: 5172 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1360 bp
Genome contig ID	gi51511730r_72711679
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TAATCTGCTTTAACAAAAATAAATGTTCATGGTAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGCTTTTGCCCATGAAGGGCTGTTCTTTCCCCTTTCCTTTATTAGTAAA

Features of the protein sequence

Description

Length: 574 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P49757	1.7e-182	100.0	Protein numb ho...	Homo sapiens
AAD54281	3.3e-182	100.0	NUMB isoform 3 ...	Homo sapiens
BAG37583	9.2e-182	99.8	unnamed protein...	Homo sapiens
XP_001150743	2.3e-181	99.4	numb homolog is...	Pan troglodytes
XP_001151476	4.5e-181	99.4	numb homolog is...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006020	3	95	PF00640	Phosphotyrosine interaction region
HMMPfam	IPR010449	96	252	PF06311	NUMB phenylalanine-rich
HMMSmart	IPR006020	1	98	SM00462	Phosphotyrosine interaction region
ProfileScan	IPR006020	13	96	PS01179	Phosphotyrosine interaction region

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp