Length: 5150 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end
Length of 3'UTR |
300 bp |
Genome contig ID |
gi89161199r_20977807 |
PolyA signal sequence (AATAAA,-28) |
+----*----+----*----+----*----+---- AGGAACAAATAAATGGAGTCTTTATTGTGTATCAT |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* ACCACTGAATGTGGCTCATTTGTATTGAAAGACAGTGAAACGAGGGCATT |
Length: 1615 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92083 |
0 |
100.0 |
Apolipoprotein ...
|
Homo sapiens
|
NP_000375 |
0 |
99.9 |
apolipoprotein ...
|
Homo sapiens
|
AAB00481 |
0 |
99.8 |
apolipoprotein ...
|
Homo sapiens
|
1211338A |
0 |
99.5 |
lipoprotein B100.
|
Homo sapiens
|
AAA35549 |
0 |
99.5 |
apolipoprotein ...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.