ORK04231

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04231

Order Kazusa clone(s) from :

Accession No	AB208847
Product ID	ORK04231
Clone name	fh26186
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ATR
cDNA sequence	DNA sequence (5190 bp) Predicted protein sequence (456 aa)
Description	Serine/threonine-protein kinase ATR (EC 2.7.11.1) (Ataxia telangiectasia and Rad3-related protein) (FRAP-related protein 1).

Features of the cloned cDNA sequence

Description

Length: 5190 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3818 bp
Genome contig ID	gi89161205r_143550770
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CATTCAGTTATTAAGAAATAAACTGCTTTCTTAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACATACTGTGCATTATAATTGGAGAAATAGAATATCATGTGTTCTTATGG

Features of the protein sequence

Description

Length: 456 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92084	8.2e-201	100.0	ataxia telangie...	Homo sapiens
Q13535	1.5e-190	100.0	Serine/threonin...	Homo sapiens
CAA70298	1.5e-190	100.0	atr [Homo sapiens].	Homo sapiens
XP_516792	1.5e-190	100.0	ataxia telangie...	Pan troglodytes
XP_001112149	3.9e-190	99.7	ataxia telangie...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000403	167	413	PF00454	Phosphatidylinositol 3- and 4-kinase
HMMSmart	IPR000403	169	456	SM00146	Phosphatidylinositol 3- and 4-kinase
ProfileScan	IPR014009	1	31	PS51189	PIK-related kinase
ProfileScan	IPR000403	168	406	PS50290	Phosphatidylinositol 3- and 4-kinase
ScanRegExp	IPR000403	306	326	PS00916	Phosphatidylinositol 3- and 4-kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp