ORK06462

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06462

Order Kazusa clone(s) from :

Accession No	AB209183
Product ID	ORK06462
Clone name	fj01654
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PPP2R2C
cDNA sequence	DNA sequence (4522 bp) Predicted protein sequence (388 aa)
Description	Serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit B gamma isoform (PP2A, subunit B, B-gamma isoform) (PP2A, subunit B, B55-gamma isoform) (PP2A, subunit B, PR55-gamma isoform) (PP2A, subunit B, R2-gamma isoform) (IMYPNO1).

Features of the cloned cDNA sequence

Description

Length: 4522 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	0 bp
Genome contig ID	gi89161207r_6286274
PolyA signal sequence (None)	+--------+--------+----*----+---- TCTCCTCCGTGTCCGACGTGAAGTTCAGCCACAGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GGCCGCTACATGCTCACCCGGGACTACCTTACAGTCAAGGTCTGGGACCT

Features of the protein sequence

Description

Length: 388 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92420	1.2e-160	100.0	gamma isoform o...	Homo sapiens
XP_001155861	4.3e-159	99.4	similar to gamm...	Pan troglodytes
XP_001156254	4.9e-159	99.4	gamma isoform o...	Pan troglodytes
XP_852811	3.1e-108	86.7	similar to gamm...	Canis lupus fam...
EAW82395	5e-107	98.9	protein phospha...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000009	127	147	PR00600	Protein phosphatase 2A
	IPR000009	162	190	PR00600	Protein phosphatase 2A
	IPR000009	191	219	PR00600	Protein phosphatase 2A
	IPR000009	268	295	PR00600	Protein phosphatase 2A
	IPR000009	296	323	PR00600	Protein phosphatase 2A
	IPR000009	324	352	PR00600	Protein phosphatase 2A
	IPR000009	353	380	PR00600	Protein phosphatase 2A
	IPR000009	381	388	PR00600	Protein phosphatase 2A
HMMSmart	IPR001680	110	148	SM00320	WD40 repeat
	IPR001680	175	215	SM00320	WD40 repeat
	IPR001680	257	296	SM00320	WD40 repeat
	IPR001680	307	347	SM00320	WD40 repeat
ScanRegExp	IPR000009	175	189	PS01024	Protein phosphatase 2A
ScanRegExp	IPR000009	266	280	PS01025	Protein phosphatase 2A

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp