Length: 4696 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end
Length of 3'UTR |
3948 bp |
Genome contig ID |
gi51511724f_86177099 |
PolyA signal sequence (ATTAAA,-20) |
+----*----+----*----+----*----+---- TGGTTCAGTAAAACTATTAAATTGAAGCTTCACAC |
Flanking genome sequence (139542 - 139591) |
----+----*----+----*----+----*----+----*----+----* ATTTGTAGTTAAAATGTTTATTTCTTTTCAACATTTGTTTTCAAGAAAGG |
Length: 248 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92422 |
6e-87 |
100.0 |
Transcription f...
|
Homo sapiens
|
Q15329 |
5.3e-86 |
100.0 |
Transcription f...
|
Homo sapiens
|
AAC50120 |
5.3e-85 |
99.5 |
E2F-5 [Homo sap...
|
Homo sapiens
|
CAB01634 |
5.3e-85 |
99.5 |
transcription f...
|
Homo sapiens
|
XP_001094919 |
9.2e-85 |
98.3 |
E2F transcripti...
|
Macaca mulatta
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
Search method |
interpro_ID |
From |
To |
Entry |
Definition |
HMMPfam |
IPR003316 |
1 |
52 |
PF02319 |
Transcription factor E2F/dimerisation partner (TDP) |