Length: 4147 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end
Length of 3'UTR |
1356 bp |
Genome contig ID |
gi51511735r_27356208 |
PolyA signal sequence (AATATA,-17) |
+----*----+----*----+----*----+---- TATCATTGTCTTTTATGAAATATAATGTTCTAAAG |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* ACTTTGTGTGAAGATGTAATTATTTTCCTCTCAGGAACTTTTTTGGGTTA |
Length: 122 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92431 |
1.3e-52 |
100.0 |
UDP-Gal:betaGlc...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.