ORK05464

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05464

Order Kazusa clone(s) from :

Accession No	AK226065
Product ID	ORK05464
Clone name	fj08016
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	HSPA14
cDNA sequence	DNA sequence (4576 bp) Predicted protein sequence (319 aa)
Description	Heat shock 70 kDa protein 14 (Heat shock protein HSP60) (HSP70-like protein 1).

Features of the cloned cDNA sequence

Description

Length: 4576 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	130 bp
Genome contig ID	gi89161187f_14830891
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- TGTATAAACTATGTTTTATTAAACTACAATATATC
Flanking genome sequence (122852 - 122901)	----+--------+--------+--------+--------+----* AGTAAGTGTTGCAACCCTTTGTTTTTGACGTACAGTAACCTCTTATTACT

Features of the protein sequence

Description

Length: 319 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAF66640	6.9e-130	100.0	heat shock prot...	Homo sapiens
Q0VDF9	6.9e-130	100.0	Heat shock 70 k...	Homo sapiens
BAF85012	2.8e-129	99.6	unnamed protein...	Homo sapiens
AAF17198	4.5e-129	99.3	heat shock prot...	Homo sapiens
XP_507667	8.3e-129	99.0	heat shock 70kD...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001023	139	155	PR00301	Heat shock protein Hsp70
FPrintScan	IPR001023	171	191	PR00301	Heat shock protein Hsp70
HMMPfam	IPR013126	2	190	PF00012	Heat shock protein 70
ScanRegExp	IPR013126	142	156	PS01036	Heat shock protein 70

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp