ORK06443

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06443

Order Kazusa clone(s) from :

Accession No	AB209246
Product ID	ORK06443
Clone name	fj17573
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PPAT
cDNA sequence	DNA sequence (4044 bp) Predicted protein sequence (217 aa)
Description	Amidophosphoribosyltransferase precursor (EC 2.4.2.14) (Glutamine phosphoribosylpyrophosphate amidotransferase) (ATASE) (GPAT).

Features of the cloned cDNA sequence

Description

Length: 4044 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1987 bp
Genome contig ID	gi89161207r_56854288
PolyA signal sequence (GATAAA,-26)	+--------+--------+----*----+---- TGCCTTGTTGATAAATATGTGTAATAAGTATGTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATATGTGTGTCCTTTTTTTTTTTTTTTTAAATAGTGACTTTAGTTAGT

Features of the protein sequence

Description

Length: 217 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92483	2e-90	100.0	phosphoribosyl ...	Homo sapiens
EAX05487	9.1e-74	99.4	phosphoribosyl ...	Homo sapiens
XP_001085606	9.2e-74	99.4	similar to phos...	Macaca mulatta
BAD96479	9.2e-74	99.4	phosphoribosyl ...	Homo sapiens
Q06203	9.2e-74	99.4	Amidophosphorib...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000836	3	139	PF00156	Phosphoribosyltransferase
ScanRegExp	IPR002375	85	97	PS00103	Purine/pyrimidine phosphoribosyl transferase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	25	CILLLIILSFLLYQCGLPYVEVL	47	PRIMARY	23