Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07604
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209247
Product ID ORK07604
Clone name fj18224
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol MGC4172
cDNA sequence DNA sequence (4505 bp)
Predicted protein sequence (153 aa)
Description Dehydrogenase/reductase SDR family member 11 precursor (EC 1.-.-.-).
Features of the cloned cDNA sequence

Length: 4505 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 534 bp
Genome contig ID gi51511734f_31927001
PolyA signal sequence
(ATTAAA,-23)		 
+----*----+----*----+----*----+----
TTCATGGTGATCATTAAAAAAGAAAAATCGCAACC
Flanking genome sequence
(104345 - 104394)		 
----+----*----+----*----+----*----+----*----+----*
AATCTGCCTTGGCTTCAGGAGTGTCTTTCCATTCTTTCCCCTTCTCTGTG

Features of the protein sequence

Length: 153 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92484 6.9e-62 100.0 hypothetical pr...
 Homo sapiens
XP_001111327 9.7e-09 58.3 similar to shor...
 Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
ScanRegExp IPR013032 44 56 PS01186 EGF-like region
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp