ORK04870

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04870

Order Kazusa clone(s) from :

Accession No	AB208821
Product ID	ORK04870
Clone name	fk03822
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	EIF2B5
cDNA sequence	DNA sequence (3458 bp) Predicted protein sequence (338 aa)
Description	Translation initiation factor eIF-2B subunit epsilon (eIF-2B GDP-GTP exchange factor subunit epsilon).

Features of the cloned cDNA sequence

Description

Length: 3458 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1616 bp
Genome contig ID	gi89161205f_185235868
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- CTTGTATATGTTAATATTAAAAGAGAGAGTGGTGT
Flanking genome sequence (109926 - 109975)	----+--------+--------+--------+--------+----* ATTTGGTTTGTCTCCATCCCTGACTAATCAGCCAGTGAAGTATGTGACCA

Features of the protein sequence

Description

Length: 338 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92058	1.2e-138	100.0	eukaryotic tran...	Homo sapiens
EAW78298	1.1e-133	100.0	eukaryotic tran...	Homo sapiens
EAW78301	1.1e-133	100.0	eukaryotic tran...	Homo sapiens
AAC50646	1.2e-133	100.0	eIF-2Bepsilon [...	Homo sapiens
Q13144	1.3e-133	100.0	Translation ini...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001451	109	126	PF00132	Bacterial transferase hexapeptide repeat
	IPR001451	132	149	PF00132	Bacterial transferase hexapeptide repeat
	IPR001451	178	195	PF00132	Bacterial transferase hexapeptide repeat

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp