Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07396
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB208862
Product ID ORK07396
Clone name fk06411
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZBTB11
cDNA sequence DNA sequence (3825 bp)
Predicted protein sequence (700 aa)
Description Zinc finger and BTB domain-containing protein 11.
Features of the cloned cDNA sequence

Length: 3825 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1720 bp
Genome contig ID gi89161205r_102750978
PolyA signal sequence
(AATAAA,-30)
+----*----+----*----+----*----+----
ATGTAAATAAAAGATGTTGAATCTTGTTGAAAAGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATGAACTTTGGAGTTGAGCTTGTTACTATTTTCAGTTCATAAATCAGTTG

Features of the protein sequence

Length: 700 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92099 0 100.0 zinc finger pro...
Homo sapiens
AAI11701 0 100.0 Zinc finger and...
Homo sapiens
O95625 0 99.8 Zinc finger and...
Homo sapiens
XP_516629 0 99.7 zinc finger pro...
Pan troglodytes
CAH92075 0 99.1 hypothetical pr...
Pongo abelii
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007087 216 238 PF00096 Zinc finger
IPR007087 244 266 PF00096 Zinc finger
IPR007087 298 320 PF00096 Zinc finger
IPR007087 326 348 PF00096 Zinc finger
IPR007087 354 376 PF00096 Zinc finger
IPR007087 382 404 PF00096 Zinc finger
IPR007087 413 435 PF00096 Zinc finger
IPR007087 441 463 PF00096 Zinc finger
IPR007087 469 493 PF00096 Zinc finger
IPR007087 505 527 PF00096 Zinc finger
IPR007087 533 555 PF00096 Zinc finger
IPR007087 561 584 PF00096 Zinc finger
HMMSmart IPR015880 216 238 SM00355 Zinc finger
IPR015880 244 266 SM00355 Zinc finger
IPR015880 298 320 SM00355 Zinc finger
IPR015880 326 348 SM00355 Zinc finger
IPR015880 354 376 SM00355 Zinc finger
IPR015880 382 404 SM00355 Zinc finger
IPR015880 413 435 SM00355 Zinc finger
IPR015880 441 463 SM00355 Zinc finger
IPR015880 469 493 SM00355 Zinc finger
IPR015880 505 527 SM00355 Zinc finger
IPR015880 533 555 SM00355 Zinc finger
IPR015880 561 584 SM00355 Zinc finger
ProfileScan IPR007087 216 243 PS50157 Zinc finger
IPR007087 244 271 PS50157 Zinc finger
IPR007087 298 325 PS50157 Zinc finger
IPR007087 326 353 PS50157 Zinc finger
IPR007087 354 381 PS50157 Zinc finger
IPR007087 382 409 PS50157 Zinc finger
IPR007087 413 440 PS50157 Zinc finger
IPR007087 441 468 PS50157 Zinc finger
IPR007087 469 498 PS50157 Zinc finger
IPR007087 505 532 PS50157 Zinc finger
IPR007087 533 560 PS50157 Zinc finger
IPR007087 561 589 PS50157 Zinc finger
ScanRegExp IPR007087 218 238 PS00028 Zinc finger
IPR007087 246 266 PS00028 Zinc finger
IPR007087 300 320 PS00028 Zinc finger
IPR007087 328 348 PS00028 Zinc finger
IPR007087 356 376 PS00028 Zinc finger
IPR007087 384 404 PS00028 Zinc finger
IPR007087 415 435 PS00028 Zinc finger
IPR007087 443 463 PS00028 Zinc finger
IPR007087 471 493 PS00028 Zinc finger
IPR007087 507 527 PS00028 Zinc finger
IPR007087 535 555 PS00028 Zinc finger
IPR007087 563 584 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp