ORK04408

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04408

Order Kazusa clone(s) from :

Accession No	AB209523
Product ID	ORK04408
Clone name	fk09742
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ARRDC1
cDNA sequence	DNA sequence (3233 bp) Predicted protein sequence (331 aa)
Description	CI037_HUMAN Isoform 2 of Q9H2J1 - Homo sapiens (Human)

Features of the cloned cDNA sequence

Description

Length: 3233 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1113 bp
Genome contig ID	gi89161216f_139527079
PolyA signal sequence (None)	+--------+--------+----*----+---- TCAGCCTGGGCAACATGGTGAAACTCCATCTGTAC
Flanking genome sequence (103401 - 103450)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAATAGCTGGGCATCATGGCACATGCTTGTA

Features of the protein sequence

Description

Length: 331 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92760	3.7e-113	100.0	arrestin domain...	Homo sapiens
Q8N5I2	4.6e-89	93.7	Arrestin domain...	Homo sapiens
EAW88404	4.6e-89	93.7	arrestin domain...	Homo sapiens
EAW88403	5e-89	93.7	arrestin domain...	Homo sapiens
XP_001116997	2.5e-84	90.0	similar to arre...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011022	51	175	PF02752	Arrestin-like

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp