ORK06316

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06316

Order Kazusa clone(s) from :

Accession No	AB209531
Product ID	ORK06316
Clone name	fk10515
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PDLIM5
cDNA sequence	DNA sequence (3096 bp) Predicted protein sequence (436 aa)
Description	PDZ and LIM domain protein 5 (Enigma homolog) (Enigma-like PDZ and LIM domains protein).

Features of the cloned cDNA sequence

Description

Length: 3096 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1412 bp
Genome contig ID	gi89161207f_95624575
PolyA signal sequence (None)	+--------+--------+----*----+---- CTCCAGCCTGGTGACAGAGCAAGACTCCGGCTCTT
Flanking genome sequence (181082 - 181131)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAAAGAGAGAGAGAGAATAAATAGAAAAG

Features of the protein sequence

Description

Length: 436 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92768	1e-174	100.0	Enigma homolog ...	Homo sapiens
XP_001103292	2.3e-159	96.6	similar to PDZ ...	Macaca mulatta
XP_001164485	1.1e-140	98.6	PDZ and LIM dom...	Pan troglodytes
XP_001164408	1.1e-140	98.6	PDZ and LIM dom...	Pan troglodytes
XP_001164561	1.3e-140	98.6	PDZ and LIM dom...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001781	258	313	PD000094	Zinc finger
	IPR001781	319	373	PD000094	Zinc finger
	IPR001781	378	430	PD000094	Zinc finger
HMMPfam	IPR001781	260	316	PF00412	Zinc finger
	IPR001781	319	375	PF00412	Zinc finger
	IPR001781	378	435	PF00412	Zinc finger
HMMSmart	IPR001781	259	310	SM00132	Zinc finger
	IPR001781	318	369	SM00132	Zinc finger
	IPR001781	377	430	SM00132	Zinc finger
ProfileScan	IPR001781	258	316	PS50023	Zinc finger
	IPR001781	317	376	PS50023	Zinc finger
	IPR001781	377	436	PS50023	Zinc finger
ScanRegExp	IPR001781	319	352	PS00478	Zinc finger
ScanRegExp	IPR001781	378	413	PS00478	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp