ORK06148

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06148

Order Kazusa clone(s) from :

Accession No	AB209549
Product ID	ORK06148
Clone name	fk12443
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	NGLY1
cDNA sequence	DNA sequence (3196 bp) Predicted protein sequence (225 aa)
Description	Peptide-N(4)-(N-acetyl-beta-glucosaminyl)asparagine amidase (EC 3.5.1.52) (PNGase) (hPNGase) (Peptide:N-glycanase) (N-glycanase 1).

Features of the cloned cDNA sequence

Description

Length: 3196 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	181 bp
Genome contig ID	gi89161205r_25635774
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- ATCTTTATACGTGGACTATAATAAAATATTGAATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAACCTTTCTTCCATATGTGACTATAATTTGGAGTAAAGTCTTGTTGAC

Features of the protein sequence

Description

Length: 225 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92786	2.5e-99	100.0	N-glycanase 1 v...	Homo sapiens
EAW64366	2.6e-94	99.5	N-glycanase 1, ...	Homo sapiens
BAG58811	1.7e-77	79.4	unnamed protein...	Homo sapiens
AAH00963	1.8e-77	79.5	Similar to pept...	Homo sapiens
EAW64363	1.8e-77	79.5	N-glycanase 1, ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR006588	58	150	SM00613	Protein of unknown function PAW

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp