Length: 3100 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end
Length of 3'UTR |
2092 bp |
Genome contig ID |
gi89161199f_54506241 |
PolyA signal sequence (AGTAAA,-8) |
+----*----+----*----+----*----+---- TGCAGTGTATACTCTTTTTCAGTATTCAGTAAAGT |
Flanking genome sequence (103101 - 103150) |
----+----*----+----*----+----*----+----*----+----* AAAAAAAAAAAAAAAAGATGTAAAGCTCATTGGCAGAGAGCATTGCTAGT |
Length: 75 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92788 |
7.4e-30 |
100.0 |
spectrin, beta,...
|
Homo sapiens
|
EAX00137 |
1.6e-23 |
100.0 |
spectrin, beta,...
|
Homo sapiens
|
BAD92985 |
1.3e-22 |
98.4 |
spectrin, beta,...
|
Homo sapiens
|
AAH92544 |
1.1e-17 |
98.0 |
Spnb2 protein [...
|
Mus musculus
|
AAX93104 |
2.9e-17 |
100.0 |
unknown [Homo s...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.