ORK01277

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01277

Order Kazusa clone(s) from :

Accession No	AK226056
Product ID	ORK01277
Clone name	fk12906
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PELP1
cDNA sequence	DNA sequence (3453 bp) Predicted protein sequence (1132 aa)
HaloTag ORF Clone	FHC01277
Flexi ORF Clone	FXC01277
Description	PELP1_HUMAN Isoform 2 of Q8IZL8 - Homo sapiens (Human)

Features of the cloned cDNA sequence

Description

Length: 3453 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	54 bp
Genome contig ID	gi51511734r_4421429
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- CTTTGTTTCCAATAAAGTTATGTCCTTAGATAGCG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTGCTGCTTCTGCCTTTTGCCACACCTGGGTCCCCAGCCAGAAGCTCAA

Features of the protein sequence

Description

Length: 1132 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG61148	99.9	unnamed protein...	Homo sapiens
Q8IZL8	100.0	Proline-, gluta...	Homo sapiens
BAF83852	99.9	unnamed protein...	Homo sapiens
AAN41255	99.8	MNAR [Homo sapi...	Homo sapiens
Q1W1Y5	98.1	Proline-, gluta...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	NULL	638	654	PR01217	NULL
	NULL	663	675	PR01217	NULL
	NULL	684	705	PR01217	NULL
	NULL	716	732	PR01217	NULL
	NULL	736	753	PR01217	NULL
	NULL	799	824	PR01217	NULL
HMMPfam	IPR012583	81	162	PF08167	NUC201
	IPR012980	425	491	PF08166	Protein of unknown function NUC202
	IPR012980	571	644	PF08166	Protein of unknown function NUC202

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp