ORK06420

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06420

Order Kazusa clone(s) from :

Accession No	AB209560
Product ID	ORK06420
Clone name	fk13737
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	POLD1
cDNA sequence	DNA sequence (3475 bp) Predicted protein sequence (1011 aa)
Description	DNA polymerase delta catalytic subunit (EC 2.7.7.7) (DNA polymerase subunit delta p125).

Features of the cloned cDNA sequence

Description

Length: 3475 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	257 bp
Genome contig ID	gi42406306f_55479273
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- ACCAGGGAGAATTAATAAAGTTCTGGACTTTTGCT
Flanking genome sequence (133811 - 133860)	----+--------+--------+--------+--------+----* ATATGGTGCTTTGTGGTCTCTGGGGGACACTGTCTGGTTTCATAAGCCCT

Features of the protein sequence

Description

Length: 1011 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92797	100.0	polymerase (DNA...	Homo sapiens
XP_001116048	97.0	polymerase (DNA...	Macaca mulatta
AAA58439	99.7	DNA polymerase-...	Homo sapiens
P28340	99.7	DNA polymerase ...	Homo sapiens
AAH08800	99.6	Polymerase (DNA...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR006172	600	613	PR00106	DNA-directed DNA polymerase B
	IPR006172	692	704	PR00106	DNA-directed DNA polymerase B
	IPR006172	753	761	PR00106	DNA-directed DNA polymerase B
HMMPfam	IPR006133	132	479	PF03104	DNA polymerase B
HMMPfam	IPR006134	552	908	PF00136	DNA polymerase
HMMSmart	IPR006172	310	767	SM00486	DNA-directed DNA polymerase B
ScanRegExp	IPR006172	755	763	PS00116	DNA-directed DNA polymerase B

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp