ORK07272

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07272

Order Kazusa clone(s) from :

Accession No	AB209566
Product ID	ORK07272
Clone name	fk14434
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	UBQLN4
cDNA sequence	DNA sequence (3479 bp) Predicted protein sequence (600 aa)
Description	Ubiquilin-4 (Ataxin-1 ubiquitin-like-interacting protein A1U).

Features of the cloned cDNA sequence

Description

Length: 3479 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1676 bp
Genome contig ID	gi89161185r_154171717
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- GGCCTTTGTAAATAAATGGCGTGGTCTTTGTTGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGAGTGTGTTGGCGTTTGTTTTTTTGAGGAAGAAGCTGGCTGAAAACAAC

Features of the protein sequence

Description

Length: 600 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92803	2.6e-168	100.0	ataxin-1 ubiqui...	Homo sapiens
BAG37034	2.6e-168	100.0	unnamed protein...	Homo sapiens
Q9NRR5	4.4e-168	99.8	Ubiquilin-4; At...	Homo sapiens
AAF80171	2.3e-167	99.3	A1U [Homo sapiens].	Homo sapiens
XP_001928530	1.6e-165	98.1	similar to atax...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000626	17	84	PF00240	Ubiquitin
HMMPfam	IPR000449	557	597	PF00627	Ubiquitin-associated/Translation elongation factor EF1B
HMMSmart	IPR000626	12	82	SM00213	Ubiquitin
	IPR006636	191	228	SM00727	Heat shock chaperonin-binding
	IPR006636	229	260	SM00727	Heat shock chaperonin-binding
	IPR006636	392	439	SM00727	Heat shock chaperonin-binding
	IPR006636	443	475	SM00727	Heat shock chaperonin-binding
	IPR000449	558	596	SM00165	Ubiquitin-associated/Translation elongation factor EF1B
ProfileScan	IPR000626	12	86	PS50053	Ubiquitin
ProfileScan	IPR000449	552	597	PS50030	Ubiquitin-associated/Translation elongation factor EF1B

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp