Length: 4399 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end
| Length of 3'UTR |
471 bp |
| Genome contig ID |
gi51511730f_55048495 |
PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- TAATGGCGTCACAAATAAAAGGATGCTTATTATTC |
Flanking genome sequence (172554 - 172603) |
----+----*----+----*----+----*----+----*----+----* AAACTTGACTTGTTCTAATTTTTATTGAGCTTTAACAGATTTCATTAGTA |
Length: 1307 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
| Entry |
Exp |
ID% |
Protein |
Source |
| AAB65853 |
0 |
100.0 |
kinectin [Homo ...
|
Homo sapiens
|
| AAI51336 |
0 |
88.6 |
KTN1 protein [B...
|
Bos taurus
|
| AAI17133 |
0 |
96.0 |
Kinectin 1 (kin...
|
Homo sapiens
|
| BAG64000 |
0 |
97.8 |
unnamed protein...
|
Homo sapiens
|
| Q86UP2 |
0 |
95.8 |
Kinectin; Kines...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Prediction of transmembrane (TM) segments
| Method |
No. |
N terminal |
transmembrane region |
C terminal |
type |
length |
SOSUI2 |
1 |
14 |
AYFIVLIPSIVITVIFLFFWLFM |
36 |
PRIMARY |
23 |