ORK10421

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10421

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10421
Clone name	ha00539
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of th ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
Symbol	SAYSD1
cDNA sequence	DNA sequence (5191 bp) Predicted protein sequence (129 aa)
Description	Uncharacterized protein C6orf64

Features of the cloned cDNA sequence

Description

Length: 5191 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	237 bp
Genome contig ID	gi89161210r_39080949
PolyA signal sequence (TATAAA,-18)	+--------+--------+----*----+---- GTGGGTCCGACGCAATTTATAAAATTTATGTACTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGAAGGGAGACCTGTTTGTTTCATTTCTCATCTGTTTGGGAGATGATTT

Features of the protein sequence

Description

Length: 129 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAB66773	2.5e-50	100.0	hypothetical pr...	Homo sapiens
Q9NPB0	2.8e-49	100.0	Uncharacterized...	Homo sapiens
EAX03976	3.2e-49	100.0	chromosome 6 op...	Homo sapiens
XP_001173836	7.8e-49	99.1	similar to chro...	Pan troglodytes
XP_001117110	1.2e-47	96.4	similar to Prot...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	52	VLLWLVLLGLFVELEFGLAYFVL	74	PRIMARY	23