Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07624
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB290160
Product ID ORK07624
Clone name hf00569y2
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol MYO5B
cDNA sequence DNA sequence (9310 bp)
Predicted protein sequence (1866 aa)
Description Homo sapiens mRNA for MYO5B/KIAA1119 variant protein
Features of the cloned cDNA sequence

Length: 9310 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 3655 bp
Genome contig ID gi51511735r_45503184
PolyA signal sequence
(AATAAA,-17)		 
+----*----+----*----+----*----+----
TGGATAAAAATTTGTGGAAATAAATACTTTTGAAT
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AAAGAGGTGTGCCAAATCTAAATGAAATTTAAAACTCTGCAGCTACAGGT

Features of the protein sequence

Length: 1866 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9ULV0 0 100.0 Myosin-Vb.
 Homo sapiens
NP_001073936 0 99.8 myosin-Vb [Homo...
 Homo sapiens
XP_001090434 0 97.2 myosin VB isofo...
 Macaca mulatta
XP_001499210 0 93.6 similar to Myos...
 Equus caballus
EDL09522 0 90.2 myosin Vb, isof...
 Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001609 210 240 PD000355 Myosin head
IPR002710 1625 1759 PD003376 Dilute
FPrintScan IPR001609 117 136 PR00193 Myosin head
IPR001609 173 198 PR00193 Myosin head
IPR001609 218 245 PR00193 Myosin head
IPR001609 450 478 PR00193 Myosin head
IPR001609 503 531 PR00193 Myosin head
HMMPfam IPR001609 88 766 PF00063 Myosin head
IPR000048 782 802 PF00612 IQ calmodulin-binding region
IPR000048 805 825 PF00612 IQ calmodulin-binding region
IPR000048 830 850 PF00612 IQ calmodulin-binding region
IPR000048 853 873 PF00612 IQ calmodulin-binding region
IPR000048 878 898 PF00612 IQ calmodulin-binding region
IPR000048 901 921 PF00612 IQ calmodulin-binding region
IPR002710 1698 1803 PF01843 Dilute
HMMSmart IPR001609 80 779 SM00242 Myosin head
IPR000048 780 802 SM00015 IQ calmodulin-binding region
IPR000048 803 825 SM00015 IQ calmodulin-binding region
IPR000048 828 850 SM00015 IQ calmodulin-binding region
IPR000048 851 873 SM00015 IQ calmodulin-binding region
IPR000048 876 898 SM00015 IQ calmodulin-binding region
IPR000048 899 921 SM00015 IQ calmodulin-binding region
ProfileScan IPR000048 782 810 PS50096 IQ calmodulin-binding region
IPR000048 804 833 PS50096 IQ calmodulin-binding region
IPR000048 829 855 PS50096 IQ calmodulin-binding region
IPR000048 853 881 PS50096 IQ calmodulin-binding region
IPR000048 877 903 PS50096 IQ calmodulin-binding region
IPR000048 900 929 PS50096 IQ calmodulin-binding region
IPR002710 1544 1821 PS51126 Dilute
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp