ORK07631

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07631

Order Kazusa clone(s) from :

Accession No	AB290157
Product ID	ORK07631
Clone name	hg00575y3
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DYNC1H1
cDNA sequence	DNA sequence (14333 bp) Predicted protein sequence (4662 aa)
Description	Homo sapiens mRNA for DYNC1H1/KIAA0325 variant protein

Features of the cloned cDNA sequence

Description

Length: 14333 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	228 bp
Genome contig ID	gi51511730f_101400618
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- CGTGGCTCCTTTGAGGAAATAAAACACTAAGCATG
Flanking genome sequence (186265 - 186314)	----+--------+--------+--------+--------+----* AGCCGGCTCCGCCTCTTCTGTCTCCGCTTTCATCCCAGGGCACAGAGCCT

Features of the protein sequence

Description

Length: 4662 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q14204	100.0	Cytoplasmic dyn...	Homo sapiens
XP_537556	99.2	similar to dyne...	Canis lupus fam...
XP_001491244	99.2	similar to dyne...	Equus caballus
NP_084514	99.1	cytoplasmic dyn...	Mus musculus
Q9JHU4	99.0	Cytoplasmic dyn...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013594	254	850	PF08385	Dynein heavy chain
	IPR013602	1333	1741	PF08393	Dynein heavy chain
	IPR011704	2235	2383	PF07728	ATPase associated with various cellular activities
	IPR011704	2606	2755	PF07728	ATPase associated with various cellular activities
	IPR004273	3931	4661	PF03028	Dynein heavy chain
HMMSmart	IPR003593	1917	2061	SM00382	AAA+ ATPase
	IPR003593	2232	2383	SM00382	AAA+ ATPase
	IPR003593	2603	2753	SM00382	AAA+ ATPase
	IPR003593	2945	3111	SM00382	AAA+ ATPase
ScanRegExp	IPR000169	2232	2242	PS00639	Peptidase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp