ORK01668

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01668

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01668
Clone name	hg00715
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	RERE
cDNA sequence	DNA sequence (6642 bp) Predicted protein sequence (1296 aa)
Description	Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein).

Features of the cloned cDNA sequence

Description

Length: 6642 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2680 bp
Genome contig ID	gi89161185r_8235053
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TATTTGTGGACATAAATAAAACCAAGCTACACTAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACCCTTGGGTGTCTCCCGTGCACTGTCTCATTCCTGGAGAGTGGGCGGG

Features of the protein sequence

Description

Length: 1296 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG10339	0	100.0	arginine-glutam...	synthetic construct
CAH70517	6e-165	96.8	arginine-glutam...	Homo sapiens
XP_514350	1.3e-164	96.5	atrophin-1 like...	Pan troglodytes
Q9P2R6	1.4e-162	96.5	Arginine-glutam...	Homo sapiens
XP_001159262	2.8e-162	96.2	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000949	44	103	PF01448	ELM2
	IPR014778	153	199	PF00249	Myb
	IPR000679	267	302	PF00320	Zinc finger
	IPR002951	328	1296	PF03154	Atrophin
HMMSmart	IPR001005	152	201	SM00717	SANT
HMMSmart	IPR000679	261	312	SM00401	Zinc finger
ProfileScan	IPR000949	44	147	PS51156	ELM2

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp