ORK10426

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10426

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10426
Clone name	hg00891s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	UBR4
cDNA sequence	DNA sequence (14836 bp) Predicted protein sequence (4838 aa)
Description	E3 ubiquitin-protein ligase UBR4 (EC 6.3.2.-)(N-recognin-4)(Zinc finger UBR1-type protein 1)(Retinoblastoma-associated factor of 600 kDa)(600 kDa retinoblastoma protein-associated factor)(RBAF600)(p600)

Features of the cloned cDNA sequence

Description

Length: 14836 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	318 bp
Genome contig ID	gi89161185r_19173595
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- TCTTGAGAAATAAACAAGTGACTTAACACACATTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAGGAAGGTGTTGCCTGCTGCTTCAACTCGTCCTCAGTGGCGCAGGCC

Features of the protein sequence

Description

Length: 4838 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q5T4S7	99.9	E3 ubiquitin-pr...	Homo sapiens
AAL83880	99.9	p600 [Homo sapi...	Homo sapiens
XP_513158	99.8	retinoblastoma-...	Pan troglodytes
XP_001501841	98.2	ubiquitin prote...	Equus caballus
XP_853095	98.1	similar to reti...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003126	1316	1384	PF02207	Zinc finger
HMMSmart	IPR013993	1316	1384	SM00396	Zinc finger
ProfileScan	IPR003126	1312	1385	PS51157	Zinc finger
ScanRegExp	IPR007087	1314	1336	PS00028	Zinc finger
ScanRegExp	IPR001920	2207	2216	PS00923	Asp/Glu racemase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	503	QMRFVPLILARLLLIFDYLLHQY	525	PRIMARY	23