ORK06108

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06108

Order Kazusa clone(s) from :

Accession No	AB209015
Product ID	ORK06108
Clone name	hg03832
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	NCALD
cDNA sequence	DNA sequence (6527 bp) Predicted protein sequence (202 aa)
Description	Neurocalcin-delta.

Features of the cloned cDNA sequence

Description

Length: 6527 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	5824 bp
Genome contig ID	gi51511724r_102667953
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- AGCTCTTGCCTGGCATTAAAGCATGTTTTTGGTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACATGATTTTCATGAGATTTTCATGCCTAAACTGCTGCCCCAGCTGAAT

Features of the protein sequence

Description

Length: 202 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92252	3e-86	100.0	Neurocalcin del...	Homo sapiens
AAH36098	3.7e-67	99.3	Neurocalcin del...	Homo sapiens
BAC28553	3.7e-67	99.3	unnamed protein...	Mus musculus
CAG05021	3.7e-67	99.3	unnamed protein...	Tetraodon nigro...
P61601	3.7e-67	99.3	Neurocalcin-delta.	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002048	104	169	PD000012	Calcium-binding EF-hand
FPrintScan	IPR001125	13	27	PR00450	Recoverin
	IPR001125	27	46	PR00450	Recoverin
	IPR001125	73	94	PR00450	Recoverin
	IPR001125	97	116	PR00450	Recoverin
	IPR001125	119	137	PR00450	Recoverin
	IPR001125	143	158	PR00450	Recoverin
HMMPfam	IPR002048	69	97	PF00036	Calcium-binding EF-hand
	IPR002048	105	133	PF00036	Calcium-binding EF-hand
	IPR002048	153	169	PF00036	Calcium-binding EF-hand
HMMSmart	IPR002048	69	97	SM00054	Calcium-binding EF-hand
HMMSmart	IPR002048	105	133	SM00054	Calcium-binding EF-hand
ProfileScan	IPR002048	45	63	PS50222	Calcium-binding EF-hand
	IPR002048	65	100	PS50222	Calcium-binding EF-hand
	IPR002048	101	136	PS50222	Calcium-binding EF-hand
	IPR002048	149	169	PS50222	Calcium-binding EF-hand
ScanRegExp	IPR002048	78	90	PS00018	Calcium-binding EF-hand
ScanRegExp	IPR002048	114	126	PS00018	Calcium-binding EF-hand

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp