ORK04400

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04400

Order Kazusa clone(s) from :

Accession No	AB209031
Product ID	ORK04400
Clone name	hh01018
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	C5
cDNA sequence	DNA sequence (5786 bp) Predicted protein sequence (1106 aa)
Description	Complement C5 precursor [Contains: Complement C5 beta chain; Complement C5 alpha chain; C5a anaphylatoxin; Complement C5 alpha' chain].

Features of the cloned cDNA sequence

Description

Length: 5786 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	2322 bp
Genome contig ID	gi89161216r_122654437
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- CAGGAAACTGATCATTAAAGCCTGAGTTTGCTTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACTGTGCTAAAAAGCCTGTTATTTTATGCTAGATCAGCTTCAACCACA

Features of the protein sequence

Description

Length: 1106 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92268	100.0	complement comp...	Homo sapiens
XP_001159689	98.0	complement comp...	Pan troglodytes
P01031	98.5	Complement C5; ...	Homo sapiens
AAI13739	98.4	Complement comp...	Homo sapiens
AAA51925	98.3	complement comp...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000020	758	803	PD003264	Anaphylatoxin/fibulin
FPrintScan	IPR001840	765	774	PR00004	Complement C3a/C4a/C5a anaphylatoxin
	IPR001840	781	792	PR00004	Complement C3a/C4a/C5a anaphylatoxin
	IPR001840	794	805	PR00004	Complement C3a/C4a/C5a anaphylatoxin
HMMPfam	IPR002890	77	363	PF01835	Alpha-2-macroglobulin
	IPR011625	532	686	PF07703	Alpha-2-macroglobulin
	IPR000020	769	803	PF01821	Anaphylatoxin/fibulin
	IPR001599	843	936	PF00207	Alpha-2-macroglobulin
HMMSmart	IPR000020	769	803	SM00104	Anaphylatoxin/fibulin
ProfileScan	IPR000020	769	803	PS01178	Anaphylatoxin/fibulin
ScanRegExp	IPR000020	769	803	PS01177	Anaphylatoxin/fibulin

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp