Length: 5656 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end
Length of 3'UTR |
1217 bp |
Genome contig ID |
gi89161185f_210755080 |
PolyA signal sequence (AATAAA,-26) |
+----*----+----*----+----*----+---- TGTCAGAATAATAAATATTGGAACCAAGACATGGT |
Flanking genome sequence (105659 - 105708) |
----+----*----+----*----+----*----+----*----+----* AAACATGTGTTGTGCTGGTTTCTGTTCATTTAAATCTGTCGGTTGCTGAG |
Length: 101 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92269 |
2.5e-35 |
100.0 |
activating tran...
|
Homo sapiens
|
EAW93383 |
2.7e-18 |
98.5 |
activating tran...
|
Homo sapiens
|
CAH72657 |
6e-18 |
98.4 |
activating tran...
|
Homo sapiens
|
AAP92420 |
6e-18 |
98.4 |
activating tran...
|
Mus musculus
|
XP_001107862 |
7e-18 |
98.4 |
activating tran...
|
Macaca mulatta
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.