Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05000
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209039
Product ID ORK05000
Clone name hh01845
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol FBXO3
cDNA sequence DNA sequence (5798 bp)
Predicted protein sequence (446 aa)
Description F-box only protein 3.
Features of the cloned cDNA sequence

Length: 5798 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 969 bp
Genome contig ID gi51511727r_33619061
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
TCACATTTTAAAAGCAAATTTTGGTTCCAATTCTG
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
TATTTTGTATAATTGCTTATTTTCCATAAACTAATATTAGTCAGCATTTG

Features of the protein sequence

Length: 446 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92276 1.2e-178 100.0 F-box only prot...
 Homo sapiens
XP_001082107 1.2e-178 100.0 similar to F-bo...
 Macaca mulatta
XP_001082360 1.5e-175 99.7 similar to F-bo...
 Macaca mulatta
Q9UK99 1.5e-175 99.7 F-box only prot...
 Homo sapiens
BAA91991 3.1e-175 99.5 unnamed protein...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom NULL 258 379 PD031761 NULL
HMMPfam IPR007474 253 379 PF04379 ApaG
ProfileScan IPR007474 253 383 PS51087 ApaG
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp