ORK07657

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07657

Order Kazusa clone(s) from :

Accession No	AB209110
Product ID	ORK07657
Clone name	hh08958
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ACACB
cDNA sequence	DNA sequence (5626 bp) Predicted protein sequence (1689 aa)
Description	Homo sapiens mRNA for Acetyl-CoA carboxylase 2 variant protein.

Features of the cloned cDNA sequence

Description

Length: 5626 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	186 bp
Genome contig ID	gi89161190f_108001364
PolyA signal sequence (AATAAA,-31)	+--------+--------+----*----+---- TCTTAATAAAAGGCCCAGGAGTGCCTCTTCCAAAC
Flanking genome sequence (187374 - 187423)	----+--------+--------+--------+--------+----* AAAAACAGCCTCCTCTCCATAGCTGGGAAGTTTATTTTGTTTTGTCTCTG

Features of the protein sequence

Description

Length: 1689 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92347	100.0	Acetyl-CoA carb...	Homo sapiens
ABF48723	99.9	acetyl-Coenzyme...	Homo sapiens
O00763	99.9	Acetyl-CoA carb...	Homo sapiens
AAR37018	99.8	acetyl-CoA carb...	Homo sapiens
NP_001084	99.8	acetyl-CoA carb...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000089	126	192	PF00364	Biotin/lipoyl attachment
	IPR013537	193	919	PF08326	Acetyl-CoA carboxylase
	IPR000022	1006	1565	PF01039	Carboxyl transferase
ProfileScan	IPR000089	126	192	PS50968	Biotin/lipoyl attachment
	IPR011762	1040	1220	PS50980	Acetyl-coenzyme A carboxyltransferase
	IPR011763	1221	1536	PS50989	Acetyl-coenzyme A carboxyltransferase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp