ORK06697

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06697

Order Kazusa clone(s) from :

Accession No	AB208827
Product ID	ORK06697
Clone name	hh10031
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	RPS6KB2
cDNA sequence	DNA sequence (5530 bp) Predicted protein sequence (127 aa)
Description	ribosomal protein S6 kinase, 70kDa, polypeptide 2

Features of the cloned cDNA sequence

Description

Length: 5530 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	4620 bp
Genome contig ID	gi51511727f_66852552
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- ACTGCTCCCGTGGAAGATTAAAGGGCTGAATCATG
Flanking genome sequence (106898 - 106947)	----+--------+--------+--------+--------+----* GTGCTGACCTGGCTCTTTGTGCTGCATGCCTAGGGGCAGGGTTGGGTTGG

Features of the protein sequence

Description

Length: 127 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92064	1.6e-55	100.0	ribosomal prote...	Homo sapiens
BAG59930	4.4e-23	80.6	unnamed protein...	Homo sapiens
EAW74620	1e-22	80.6	ribosomal prote...	Homo sapiens
EAW74621	1.1e-22	80.6	ribosomal prote...	Homo sapiens
Q9UBS0	1.1e-22	80.6	Ribosomal prote...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	57	93	PD000001	Protein kinase
HMMPfam	IPR000719	57	102	PF00069	Protein kinase
ProfileScan	IPR000719	57	127	PS50011	Protein kinase
ScanRegExp	IPR000719	63	89	PS00107	Protein kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp