ORK06050

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06050

Order Kazusa clone(s) from :

Accession No	AB209113
Product ID	ORK06050
Clone name	hh11957
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MTHFR
cDNA sequence	DNA sequence (5953 bp) Predicted protein sequence (672 aa)
Description	Methylenetetrahydrofolate reductase (EC 1.5.1.20).

Features of the cloned cDNA sequence

Description

Length: 5953 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3757 bp
Genome contig ID	gi89161185r_11668691
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- AGACTCTGTCTCAAAAATAAACAAAAAAACTTGAC
Flanking genome sequence (99683 - 99634)	----+--------+--------+--------+--------+----* AAAAAAATGCTACTGTCCTCGTGTACCTATTCTGATCCTCAACTGCACCG

Features of the protein sequence

Description

Length: 672 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92350	100.0	5,10-methylenet...	Homo sapiens
CAB41971	100.0	methylenetetrah...	Homo sapiens
XP_001141277	99.8	5,10-methylenet...	Pan troglodytes
EAW71708	99.8	5,10-methylenet...	Homo sapiens
XP_001105108	97.5	similar to 5,10...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003171	78	367	PF02219	Methylenetetrahydrofolate reductase
HMMTigr	IPR004621	89	372	TIGR00677	Eukaryotic-type methylenetetrahydrofolate reductase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp