Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07658
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209123
Product ID ORK07658
Clone name hh15512
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol NAIP
cDNA sequence DNA sequence (5937 bp)
Predicted protein sequence (837 aa)
Description Baculoviral IAP repeat-containing 1 variant (Fragment).
Features of the cloned cDNA sequence

Length: 5937 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 1621 bp
Genome contig ID gi51511721r_69324621
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TCTATTTAAAACAAAAATAAATCTAGTTTAGCACT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAATATTAACTGGAGCTACCTCTGGAGGGCAAGAGTACTAGAAGGTGGG

Features of the protein sequence

Length: 837 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92360 0 100.0 baculoviral IAP...
Homo sapiens
NP_075043 0 99.6 baculoviral IAP...
Homo sapiens
Q13075 0 99.6 Baculoviral IAP...
Homo sapiens
AAC52047 0 99.6 neuronal apopto...
Homo sapiens
XP_001156604 0 98.9 baculoviral IAP...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007111 1 52 PF05729 NACHT nucleoside triphosphatase
ProfileScan IPR007111 1 192 PS50837 NACHT nucleoside triphosphatase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp