Length: 4977 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end
| Length of 3'UTR |
484 bp |
| Genome contig ID |
gi89161190r_47501583 |
PolyA signal sequence (AAGAAA,-13) |
+----*----+----*----+----*----+---- TCAAAAAAAAAAAAAAAAAAAAAAGAAAAAAAAAT |
Flanking genome sequence (67464 - 67415) |
----+----*----+----*----+----*----+----*----+----* AAAACACTCATATACAGTAGCCCCTTCTTATCCGTGGTCTTGTTTTCCAT |
Length: 119 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
| Entry |
Exp |
ID% |
Protein |
Source |
| BAD92255 |
2.6e-48 |
100.0 |
FK506 binding p...
|
Homo sapiens
|
| Q9NYL4 |
1.1e-25 |
96.1 |
Peptidyl-prolyl...
|
Homo sapiens
|
| XP_001159891 |
1.1e-25 |
96.1 |
similar to FK50...
|
Pan troglodytes
|
| XP_001104575 |
2.6e-25 |
94.8 |
similar to FK50...
|
Macaca mulatta
|
| XP_001504182 |
3e-24 |
90.9 |
similar to FK50...
|
Equus caballus
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Prediction of transmembrane (TM) segments
| Method |
No. |
N terminal |
transmembrane region |
C terminal |
type |
length |
SOSUI2 |
1 |
5 |
PHLNLVSFIVVGFAVAYAPYF |
25 |
PRIMARY |
21 |
2 |
71 |
VKGILPLVGMAMVPALLGLIGYH |
93 |
PRIMARY |
23 |