ORK04874

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04874

Order Kazusa clone(s) from :

Accession No	AB209021
Product ID	ORK04874
Clone name	hj03766
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	EIF4A2
cDNA sequence	DNA sequence (5267 bp) Predicted protein sequence (67 aa)
Description	Eukaryotic initiation factor 4A-II (EC 3.6.1.-) (ATP-dependent RNA helicase eIF4A-2) (eIF4A-II) (eIF-4A-II).

Features of the cloned cDNA sequence

Description

Length: 5267 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	5063 bp
Genome contig ID	gi89161205f_187884913
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AAGTTTGAATGTTAAATAAATTGTATATTCACTTT
Flanking genome sequence (105466 - 105515)	----+--------+--------+--------+--------+----* AAAGGTGCTTTTGGTCATTTTATTTTTATTACAACTTCATTATTTACAAA

Features of the protein sequence

Description

Length: 67 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92258	5e-30	100.0	BM-010 variant ...	Homo sapiens
XP_860356	7.7e-27	100.0	similar to euka...	Canis lupus fam...
EDL78075	1.8e-25	100.0	eukaryotic tran...	Rattus norvegicus
XP_860879	2.7e-25	100.0	similar to euka...	Canis lupus fam...
XP_001103041	2.9e-25	100.0	similar to euka...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR014014	24	52	PS51195	RNA helicase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp