ORK06298

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06298

Order Kazusa clone(s) from :

Accession No	AB208874
Product ID	ORK06298
Clone name	hj05056
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PCSK1
cDNA sequence	DNA sequence (4815 bp) Predicted protein sequence (724 aa)
Description	Neuroendocrine convertase 1 precursor (EC 3.4.21.93) (NEC 1) (PC1) (Prohormone convertase 1) (Proprotein convertase 1).

Features of the cloned cDNA sequence

Description

Length: 4815 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2638 bp
Genome contig ID	gi51511721r_95651825
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- ATAAATCAGAAAAATAAATTGTTTCTCACTAAGTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAGAAAAAAAGCTCATGTTTCCACCACAAACAAGATCTCCCTCTTTTA

Features of the protein sequence

Description

Length: 724 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92111	100.0	proprotein conv...	Homo sapiens
AAI30296	99.8	Proprotein conv...	Homo sapiens
XP_517645	99.7	proprotein conv...	Pan troglodytes
P29120	99.5	Neuroendocrine ...	Homo sapiens
CAA46031	99.4	PC1/PC3 [Homo s...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002884	468	566	PD000717	Proprotein convertase
FPrintScan	IPR000209	129	148	PR00723	Peptidase S8 and S53
	IPR000209	175	188	PR00723	Peptidase S8 and S53
	IPR000209	350	366	PR00723	Peptidase S8 and S53
HMMPfam	IPR000209	112	413	PF00082	Peptidase S8 and S53
HMMPfam	IPR002884	475	567	PF01483	Proprotein convertase
ScanRegExp	IPR000209	134	145	PS00136	Peptidase S8 and S53
	IPR000209	179	189	PS00137	Peptidase S8 and S53
	IPR000209	351	361	PS00138	Peptidase S8 and S53

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp