ORK06768

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06768

Order Kazusa clone(s) from :

Accession No	AB208875
Product ID	ORK06768
Clone name	hk07237
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	SEPT10
cDNA sequence	DNA sequence (4075 bp) Predicted protein sequence (274 aa)
Description	Septin-10.

Features of the cloned cDNA sequence

Description

Length: 4075 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3249 bp
Genome contig ID	gi89161199r_109557663
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TCTAAGTTGTAAATAAAACCTTGCATAGCACAATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TATCTGTATACTTTAAATTTTATTTTTGCATTTGAAATTCACAGATGTCT

Features of the protein sequence

Description

Length: 274 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92112	7.8e-95	100.0	septin 10 isofo...	Homo sapiens
AAH50345	1.2e-94	100.0	SEPT10 protein ...	Homo sapiens
EAW53860	1.3e-94	100.0	septin 10, isof...	Homo sapiens
XP_001140264	1.8e-94	99.6	septin 10 isofo...	Pan troglodytes
XP_525857	1.9e-94	99.6	septin 10 isofo...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000038	1	49	PD002565	Cell division/GTP binding protein
HMMPfam	IPR000038	1	160	PF00735	Cell division/GTP binding protein

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp