ORK07671

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07671

Order Kazusa clone(s) from :

Accession No	AB290178
Product ID	ORK07671
Clone name	hk07299y1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MYO1F
cDNA sequence	DNA sequence (4303 bp) Predicted protein sequence (1149 aa)
Description	Homo sapiens mRNA for MYO1F variant protein

Features of the cloned cDNA sequence

Description

Length: 4303 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	738 bp
Genome contig ID	gi42406306r_8391809
PolyA signal sequence (ACTAAA,-18)	+--------+--------+----*----+---- AGCAAAACCCTGTTTCTACTAAAAATTTAAAAAAG
Flanking genome sequence (99865 - 99816)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAGCCGGGTGTGGTGGTGCCTGCCTGTAATCCCAGCTACT

Features of the protein sequence

Description

Length: 1149 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE06119	100.0	MYO1F variant p...	Homo sapiens
BAG06732	100.0	MYO1F variant p...	Homo sapiens
AAH28071	99.9	Myosin IF [Homo...	Homo sapiens
AAX29922	99.9	myosin IF [synt...	synthetic construct
O00160	99.5	Myosin-If; Myos...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001609	192	227	PD000355	Myosin head
BlastProDom	IPR001452	1095	1147	PD000066	Src homology-3
FPrintScan	IPR001609	98	117	PR00193	Myosin head
	IPR001609	154	179	PR00193	Myosin head
	IPR001609	200	227	PR00193	Myosin head
	IPR001609	432	460	PR00193	Myosin head
	IPR001609	485	513	PR00193	Myosin head
	IPR001452	1095	1105	PR00452	Src homology-3
	IPR001452	1109	1124	PR00452	Src homology-3
	IPR001452	1126	1135	PR00452	Src homology-3
	IPR001452	1137	1149	PR00452	Src homology-3
HMMPfam	IPR001609	70	728	PF00063	Myosin head
	IPR000048	745	765	PF00612	IQ calmodulin-binding region
	IPR010926	767	969	PF06017	Myosin tail 2
	IPR001452	1095	1149	PF00018	Src homology-3
HMMSmart	IPR001609	62	742	SM00242	Myosin head
HMMSmart	IPR001452	1095	1149	SM00326	Src homology-3
ProfileScan	IPR000048	748	773	PS50096	IQ calmodulin-binding region
ProfileScan	IPR001452	1092	1149	PS50002	Src homology-3

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp