ORK07682

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07682

Order Kazusa clone(s) from :

Accession No	AB210042
Product ID	ORK07682
Clone name	pf00940
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	TSHZ1
cDNA sequence	DNA sequence (7081 bp) Predicted protein sequence (1090 aa)
Description	SDCCAG33 variant protein

Features of the cloned cDNA sequence

Description

Length: 7081 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1303 bp
Genome contig ID	gi51511735f_71023807
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- AGATGTAAAATAAACCCACATGCAGTTCTTGATTT
Flanking genome sequence (107081 - 107130)	----+--------+--------+--------+--------+----* ACACGGATTGTCATGTCGTCATTATTTTGCCTTTGAGATGTTATTTCAGC

Features of the protein sequence

Description

Length: 1090 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE06124	100.0	SDCCAG33 varian...	Homo sapiens
XP_001091328	97.4	similar to teas...	Macaca mulatta
Q6ZSZ6	100.0	Teashirt homolo...	Homo sapiens
XP_001137580	99.5	teashirt family...	Pan troglodytes
AAI52773	100.0	Teashirt zinc f...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	259	283	PF00096	Zinc finger
	IPR007087	320	344	PF00096	Zinc finger
	IPR001356	899	966	PF00046	Homeobox
	IPR007087	983	1005	PF00096	Zinc finger
	IPR007087	1050	1073	PF00096	Zinc finger
HMMSmart	IPR015880	259	283	SM00355	Zinc finger
	IPR015880	320	344	SM00355	Zinc finger
	IPR015880	429	453	SM00355	Zinc finger
	IPR001356	897	971	SM00389	Homeobox
	IPR015880	983	1005	SM00355	Zinc finger
	IPR015880	1050	1073	SM00355	Zinc finger
ProfileScan	IPR007087	320	349	PS50157	Zinc finger
	IPR007087	983	1007	PS50157	Zinc finger
	IPR007087	1050	1078	PS50157	Zinc finger
ScanRegExp	IPR007087	261	283	PS00028	Zinc finger
	IPR007087	322	344	PS00028	Zinc finger
	IPR007087	985	1005	PS00028	Zinc finger
	IPR007087	1052	1073	PS00028	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp