ORK06773

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06773

Order Kazusa clone(s) from :

Accession No	AB209677
Product ID	ORK06773
Clone name	pf04987
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	SEPT7
cDNA sequence	DNA sequence (6976 bp) Predicted protein sequence (381 aa)
Description	Septin-7 (CDC10 protein homolog).

Features of the cloned cDNA sequence

Description

Length: 6976 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	5829 bp
Genome contig ID	gi89161213f_35738933
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- GTAAAAAATTCACATAATAAACGATGTTGTGATGT
Flanking genome sequence (172509 - 172558)	----+--------+--------+--------+--------+----* AATATTGTGTGAGGTCTTAAATATCCTACAGTCGATGTACAAGAGTAGAG

Features of the protein sequence

Description

Length: 381 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92914	4.8e-142	100.0	CDC10 protein v...	Homo sapiens
Q5R1W1	4.9e-136	99.7	Septin-7; CDC10...	Pan troglodytes
Q5R481	4.9e-136	99.7	Septin-7.	Pongo abelii
AAI28739	3.4e-135	99.1	Septin 7 [Rattu...	Rattus norvegicus
CAH93435	3.9e-135	99.1	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000038	139	197	PD002565	Cell division/GTP binding protein
FPrintScan	IPR008115	219	231	PR01742	Septin 7
FPrintScan	IPR008115	314	326	PR01742	Septin 7
HMMPfam	IPR000038	33	309	PF00735	Cell division/GTP binding protein

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	360	DSEAEVISLISHLLADIVFLFK	381	PRIMARY	22